Review



plko 1 blast scramble cctaaggttaagtcgccctcg  (Addgene inc)


Bioz Verified Symbol Addgene inc is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 94
      Buy from Supplier

    Structured Review

    Addgene inc plko 1 blast scramble cctaaggttaagtcgccctcg
    Plko 1 Blast Scramble Cctaaggttaagtcgccctcg, supplied by Addgene inc, used in various techniques. Bioz Stars score: 94/100, based on 134 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/plko+1+blast+scramble/pmc12709618-506-31-33?v=Addgene+inc
    Average 94 stars, based on 134 article reviews
    plko 1 blast scramble cctaaggttaagtcgccctcg - by Bioz Stars, 2026-07
    94/100 stars

    Images



    Similar Products

    plko 1 blast scramble cctaaggttaagtcgccctcg  (Addgene inc)
    94
    Addgene inc plko 1 blast scramble cctaaggttaagtcgccctcg
    Plko 1 Blast Scramble Cctaaggttaagtcgccctcg, supplied by Addgene inc, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/plko+1+blast+scramble/pmc12709618-506-31-33?v=Addgene+inc
    Average 94 stars, based on 1 article reviews
    plko 1 blast scramble cctaaggttaagtcgccctcg - by Bioz Stars, 2026-07
    94/100 stars
    		  Buy from Supplier
    plasmid plko 1 blast scramble control  (Addgene inc)
    93
    Addgene inc plasmid plko 1 blast scramble control
    Plasmid Plko 1 Blast Scramble Control, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/plko+1+blast+scramble/pmc12709618-1494-0-4?v=Addgene+inc
    Average 93 stars, based on 1 article reviews
    plasmid plko 1 blast scramble control - by Bioz Stars, 2026-07
    93/100 stars
    		  Buy from Supplier
    plko 1 blast scramble control cctaaggttaagtcgccctcg  (Addgene inc)
    93
    Addgene inc plko 1 blast scramble control cctaaggttaagtcgccctcg
    Plko 1 Blast Scramble Control Cctaaggttaagtcgccctcg, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/plko+1+blast+scramble/pmc12709618-1511-0-4?v=Addgene+inc
    Average 93 stars, based on 1 article reviews
    plko 1 blast scramble control cctaaggttaagtcgccctcg - by Bioz Stars, 2026-07
    93/100 stars
    		  Buy from Supplier
    plko 1 blast scramble control addgene  (Addgene inc)
    93
    Addgene inc plko 1 blast scramble control addgene
    Plko 1 Blast Scramble Control Addgene, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/plko+1+blast+scramble/pm41344331-297-201-203?v=Addgene+inc
    Average 93 stars, based on 1 article reviews
    plko 1 blast scramble control addgene - by Bioz Stars, 2026-07
    93/100 stars
    		  Buy from Supplier
    cctaaggttaagtcgccctcg addgene  (Addgene inc)
    93
    Addgene inc cctaaggttaagtcgccctcg addgene
    Cctaaggttaagtcgccctcg Addgene, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/plko+1+blast+scramble/pm41344331-298-23-24?v=Addgene+inc
    Average 93 stars, based on 1 article reviews
    cctaaggttaagtcgccctcg addgene - by Bioz Stars, 2026-07
    93/100 stars
    		  Buy from Supplier
    lentiviral construct plko 1 blast scramble  (Addgene inc)
    93
    Addgene inc lentiviral construct plko 1 blast scramble
    Lentiviral Construct Plko 1 Blast Scramble, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/plko+1+blast+scramble/pm40579589-393-1-11?v=Addgene+inc
    Average 93 stars, based on 1 article reviews
    lentiviral construct plko 1 blast scramble - by Bioz Stars, 2026-07
    93/100 stars
    		  Buy from Supplier
    26701 5 cctaaggttaagtcgccctcg 3  (Addgene inc)
    93
    Addgene inc 26701 5 cctaaggttaagtcgccctcg 3
    26701 5 Cctaaggttaagtcgccctcg 3, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/plko+1+blast+scramble/bio_rxiv__2025__06__23__661091-151-38-37?v=Addgene+inc
    Average 93 stars, based on 1 article reviews
    26701 5 cctaaggttaagtcgccctcg 3 - by Bioz Stars, 2026-07
    93/100 stars
    		  Buy from Supplier
    scramble shrna  (Addgene inc)
    93
    Addgene inc scramble shrna
    Scramble Shrna, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/plko+1+blast+scramble/pmc11980838-319-7-9?v=Addgene+inc
    Average 93 stars, based on 1 article reviews
    scramble shrna - by Bioz Stars, 2026-07
    93/100 stars
    		  Buy from Supplier

    Image Search Results